Alpha¹ by KaimenConfidential

Kaimen Rigor review

Malaria vaccine protection against intradermal or venous parasites: a randomized phase 2b human challenge trial.

Kapulu MC, Orenge F, Kimani D, Kibwana E, Kibet H, Mutahi M, Datoo MS, Bellamy D, Musembi J, Ngoto O, Rashid H, Akinyi S, Mwatasa MH, Nyamako L, Keter K, Gatheru R, Mutiso A, Musyoki J, Mwacharo J, Abebe Y, James ER, Billingsley PF, Ngetsa C, Mosobo M, Makale J, Tawa B, Wamae K, Ochola-Oyier LI, Lawrie A, Ramos-Lopez F, Roberts R, Richie TL, Sim BKL, Hoffman SL, Ewer KJ, Hill AVS, Hamaluba M, Bejon P

DOI: 10.1038/s41591-025-04107-6
Record issued: 2026-08-15
Engine: 7.39.0
Exported: 2026-09-20

Prepared by Alpha1. This document is confidential: it is intended for the recipient it was shared with and must not be redistributed. The live record at alpha1science.com/verify/564920e9-fc10-412a-8a4f-7dcec8558bab is authoritative.

Kaimen Rigor review

Kaimen Rigor reviewed

2 / 5

Weak — serious problems found

Interventional Study

Critical

High-priority

How this rating was calculated

Started at 5★ — deductions

IntegrityIntegrity concern ×2−1★
ClaimsOverstated claim−0.5★
ClaimsEfficacy rests on an unvalidated surrogate endpoint−0.5★
ClaimsTreatment effect not shown to be clinically meaningful−0.5★
StatisticsPrinted percentage does not match its own count (capped) ×2−0.25★
CitationsUnresolved reference−0.25★

Model-reported confidence: highReviewer agreement: moderateEngine: 7.39.0Source: full text

Not verified in this report

The numeric-impossibility checks (GRIM/GRIMMER/DEBIT/SPRITE) did not run: 18 reported means were read, and their group size is not stated where the values are printed (this source has no machine-readable table structure). These checks need the count the mean was averaged over, so none was performed.

Biggest issues

01Efficacy rests on an unvalidated surrogate endpoint
highOverreachreviewer-assessedFull detail
The primary efficacy endpoint is time to meeting treatment criteria (parasitemia ≥500 parasites/μl or any parasitemia with clinical symptoms), which is a surrogate for clinical malaria. The paper does not provide evidence that this surrogate is validated as a reliable predictor of clinical outcomes such as severe disease or mortality, nor does it demonstrate target engagement at the tested dose beyond antibody titers. The claim of protection against ID challenge is based on this surrogate without establishing a link to clinical benefit.
“The prespecified primary endpoint was time to meeting treatment criteria (that is, reaching the parasitaemia threshold of 500 parasites μl −1 or any parasitaemia plus important clinical symptoms).”
Find in source
02Treatment effect not shown to be clinically meaningful
highOverreachreviewer-assessedFull detail
The primary reported effect is that 0/12 R21-vaccinated volunteers met the primary endpoint after ID challenge, compared to 5/5 after DVI challenge. While this is statistically significant, the effect size is presented as a binary outcome without anchoring to a clinically meaningful difference. The paper does not provide a minimal clinically important difference or a comparison to a clinically relevant threshold. The small sample size (n=5 for DVI) further limits the interpretability of the effect size.
“none of the 12 volunteers vaccinated by R21 met the primary endpoint following challenge with ID PfSPZ... five of five R21 vaccinated volunteers receiving DVI sporozoites met the primary endpoint ( P < 0.0005 by log rank across all groups).”
Find in source
03Printed percentage does not match its own count
mediumArithmeticrecomputedFull detail
32% does not match the reported count 12/37
“12/37 (32.0%)”
Find in source
04Printed percentage does not match its own count
mediumArithmeticrecomputedFull detail
32% does not match the reported count 12/37
“12/37 (32.0%)”
ResultsFind in source
05Conclusion reaches beyond the evidence
mediumOverreachreviewer-assessedFull detail
Sporozoites causing infection in the face of high-titer anti-CSP antibodies result from occasional capillary injection by mosquito bites.
“we conclude that sporozoites causing infection in the face of high-titer anti-CSP antibodies induced by RTS,S or by R21 result from the occasional injection of capillary sporozoites by mosquito bites”
DiscussionFind in source

Findings by category

201ArithmeticNumerical inconsistencies 402OverreachOverstated conclusions 03AuthenticityNone found 04DisclosureNone found 105AvailabilityBroken references and links 06Copyedit9 minor suggestions

This Kaimen Rigor review uses Kaimen Rigor reviewers trained on a curated corpus of high-fidelity and retracted papers, with expert supervision and curation. It can still make mistakes; verify each finding against the source before relying on it.

This is a well-conducted phase 2b randomized controlled human challenge trial with strong ethical approvals, clear reporting of demographics, and a concrete data availability statement. The main weaknesses are the small sample size (especially the DVI R21 group, n=5), the power analysis not matching actual group sizes, and imprecise reporting of p-values as thresholds rather than exact values.

All three reviewers classified the study as interventional; no disagreement. The evaluation covered the full text, including methods, results, and supplementary information. Not applicable criteria (e.g., cell line authentication, housing conditions) were excluded. The statistics verification component recomputed only a subset of tests (6 total, 4 consistent, 2 inconsistent but not decision errors); this does not constitute a full validation of all statistical results.

Numerical inconsistencies

2 findings · worst medium

Values that contradict each other or are impossible for the stated sample: recomputed p-values and test statistics, GRIM/GRIMMER checks on summary numbers, percentages against their own counts, totals against their parts, and estimates against their own confidence intervals.

Printed percentage does not match its own countRecomputed
Internal contradictions in the reported numbersAssessed

Recomputed 4 tests: 4 consistent, 0 inconsistent; 4 via agent-written checks. 2 printed percentages that do not match their own count.

Numeric forensics— values impossible for the reported sample size

PERCENT
32% does not match the reported count 12/37
“12/37 (32.0%)”
Find in source
PERCENT
32% does not match the reported count 12/37
“12/37 (32.0%)”
ResultsFind in source

Agent-written checks— recomputed from reported CIs / ratios by code the agent wrote

CONSISTENTreported p < .001 · recomputed p = <.001Reviewer 1
Fisher's exact test for R21 ID vs DVI protection (primary endpoint)
“0 out of 12 volunteers challenged by ID met the primary endpoint of requiring treatment versus 5 out of 5 challenged by DVI, P < 0.001 by Fisher’s two-sided test”
Find in source
Taken as given: The 0 and 12 are the events and non-events in the R21 ID group.; The 5 and 0 are the events and non-events in the R21 DVI group.; The test is two-sided Fisher's exact.
Method: Two-sided Fisher's exact test on the 2x2 table [0,12;5,0].
How we recomputed it: pFisher2x2(0,12,5,0,0)
CONSISTENTreported p = .009 · recomputed p = .009Reviewer 1
Fisher's exact test for sensitivity analysis (ID vs DVI protection including PCR-positive as events)
“If we include these volunteers as meeting an exploratory endpoint for purposes of a sensitivity analysis, protection is nevertheless substantial by ID (9 out of 12, 75%), and statistically significantly different from DVI (0 out of 5 protected, P = 0.009 by Fisher’s two-sided test).”
Find in source
Taken as given: The 3 and 9 are the events and non-events in the R21 ID group (3 PCR-positive, 9 protected).; The 5 and 0 are the events and non-events in the R21 DVI group (5 met endpoint, 0 protected).; The test is two-sided Fisher's exact.
Method: Two-sided Fisher's exact test on the 2x2 table [3,9;5,0].
How we recomputed it: pFisher2x2(3,9,5,0,0)
CONSISTENTreported p = .009 · recomputed p = .009Reviewer 2
Fisher's exact test for R21 ID vs DVI protection (9/12 vs 0/5 protected)
“protection is nevertheless substantial by ID (9 out of 12, 75%), and statistically significantly different from DVI (0 out of 5 protected, P = 0.009 by Fisher’s two-sided test).”
Find in source
Taken as given: The numbers 9, 12, 0, 5 are the protected and total counts for ID and DVI groups respectively.; The test is two-sided Fisher's exact test.
Method: Two-sided Fisher's exact test on 2x2 table (9,3,0,5).
How we recomputed it: pFisher2x2(9,3,0,5,0)
CONSISTENTreported p = .009 · recomputed p = .009Reviewer 3
Fisher's exact test comparing protection (0/5 vs 9/12) between DVI and ID in R21 vaccinees.
“protection is nevertheless substantial by ID (9 out of 12, 75%), and statistically significantly different from DVI (0 out of 5 protected, P = 0.009 by Fisher’s two-sided test).”
Find in source
Taken as given: The numbers 5 and 0 are the total and protected in DVI group.; The numbers 12 and 9 are the total and protected in ID group.; The test is two-sided Fisher's exact.
Method: Fisher's exact test on 2x2 table (DVI: 5 events, 0 non-events; ID: 3 events, 9 non-events).
How we recomputed it: pFisher2x2(5,0,3,9,0)

lowinternal contradiction
The abstract states 'Seven of 8 (88%) control volunteers and 11 of 12 (92%) ME-TRAP vaccinated volunteers' but the results section says 'All 8 unvaccinated control volunteers and all 12 volunteers vaccinated with ME-TRAP became PCR positive' - the abstract's percentages are consistent with the primary endpoint, not PCR positivity, so this is not a contradiction.
“Seven of 8 (88%) control volunteers and 11 of 12 (92%) ME-TRAP vaccinated volunteers, but none of the 12 R21 vaccinated volunteers receiving ID challenge met the prespecified treatment criteria”
AbstractFind in source
lowinternal contradiction
Table 2 reports 'Treated, nonfebrile' for R21 DVI as 0% (0/12) but the group size is n=5, and the row total for that group is inconsistent.
Treated, nonfebrile, % ( n / N ) | 0% (0/12) for R21 DVI
Table 2reviewer’s wording

Overstated conclusions

4 findings · worst high

Conclusions that reach past what the paper's own results support — including a significance claim that no longer holds when the statistic is recomputed, and efficacy resting on an unvalidated surrogate endpoint.

Efficacy rests on an unvalidated surrogate endpointAssessed
Treatment effect not shown to be clinically meaningfulAssessed
Conclusions overstated beyond the evidenceAssessed
Conclusions only partially backed by the presented evidenceAssessed

9 major claims checked against the paper's own evidence: 1 not fully backed by the presented evidence (unsupported or overstated), 2 only partially supported (evidence backs part of the claim; gaps or caveats remain).

overstatedReviewer 2
Sporozoites causing infection in the face of high-titer anti-CSP antibodies result from occasional capillary injection by mosquito bites.
This is a plausible hypothesis but not directly tested in this study; it is an extrapolation from the observed route-dependent protection.
Evidence: The paper's data show route-dependent protection, but the specific claim about mosquito bite capillary injection is not directly measured.
“we conclude that sporozoites causing infection in the face of high-titer anti-CSP antibodies induced by RTS,S or by R21 result from the occasional injection of capillary sporozoites by mosquito bites”
DiscussionFind in source
partialReviewers 1, 2
The difference in protective efficacy by challenge route is due to a qualitatively different interaction between anti-CSP antibodies and sporozoites, not a dose effect.
The claim is supported by the similar infection rates and growth curves in unvaccinated controls across routes, but the small sample size and lack of direct mechanistic evidence limit the strength.
Evidence: Unvaccinated controls had similar infection rates (8/8 ID vs 32/34 DVI) and similar growth curves; the authors argue this implies similar effective inoculum.
“We conclude that the different doses resulted in a similar effective inoculum reaching the liver in unvaccinated volunteers, and therefore that the differences seen among R21 vaccinated volunteers imply a qualitatively different interaction between anti-CSP antibodies and PfSPZ challenge that is dependent on the route of challenge.”
DiscussionFind in source
partialReviewer 3
The results explain the 'leaky' protection observed in field trials.
The paper provides a plausible hypothesis but does not directly test it in the field; it is an inference from the data.
Evidence: Discussion synthesizes findings with prior animal models and mosquito bite data.
“we conclude that sporozoites causing infection in the face of high-titer anti-CSP antibodies induced by RTS,S or by R21 result from the occasional injection of capillary sporozoites by mosquito bites, producing noise in the correlation between antibody titers and the endpoint, which explains the leaky protection.”
DiscussionFind in source
supportedReviewers 1, 2
R21/Matrix-M was highly protective against CHMI using ID inoculation of sporozoites, but not against DVI sporozoites.
The claim is directly supported by the primary endpoint results: 0/12 R21 ID met the primary endpoint vs 5/5 R21 DVI, with statistical significance.
Evidence: Primary endpoint results: 0/12 R21 ID vs 5/5 R21 DVI met the primary endpoint; P < 0.0005 by log-rank.
“R21/Matrix-M was highly protective against CHMI using ID. inoculation of sporozoites, but not against DVI sporozoites.”
AbstractFind in source
supportedReviewers 1, 2
ME-TRAP was not protective against CHMI in this study.
The claim is supported by the primary endpoint results: 11/12 ME-TRAP volunteers met the primary endpoint, similar to controls.
Evidence: 11 of 12 ME-TRAP volunteers met the primary endpoint, compared to 7/8 controls.
“Seven of eight control volunteers (88%) and 11 of 12 ME-TRAP volunteers (92%) met the criteria for the primary endpoint”
ResultsFind in source
supportedReviewer 1
Correlates of efficacy for antibodies to sporozoites should be assessed by separate DVI and ID challenges.
This is a reasonable recommendation based on the study's findings, though it is a forward-looking suggestion rather than a direct result.
Evidence: The study demonstrates route-dependent efficacy, supporting the need for separate assessment.
“Correlates of efficacy for antibodies to sporozoites should also be assessed by separate DVI and ID challenges.”
AbstractFind in source
supportedReviewer 3
R21/Matrix-M is highly protective against intradermal CHMI but not against direct venous inoculation.
The primary endpoint data directly support this claim: 0/12 ID vs 5/5 DVI met the primary endpoint.
Evidence: Primary outcomes: none of the 12 R21 ID met primary endpoint; all 5 R21 DVI met primary endpoint.
“R21/Matrix-M was highly protective against CHMI using ID. inoculation of sporozoites, but not against DVI sporozoites.”
AbstractFind in source
supportedReviewer 3
ME-TRAP vaccine was not protective against CHMI.
11/12 ME-TRAP volunteers met the primary endpoint, similar to controls, supporting lack of efficacy.
Evidence: Primary outcomes: 11 of 12 ME-TRAP volunteers met the primary endpoint.
“Seven of 8 (88%) control volunteers and 11 of 12 (92%) ME-TRAP vaccinated volunteers, but none of the 12 R21 vaccinated volunteers receiving ID challenge met the prespecified treatment criteria for the primary endpoint.”
AbstractFind in source
supportedReviewer 3
The difference in protection by route is statistically significant.
The log-rank test across all groups and Fisher's exact test support significance.
Evidence: P < 0.0005 by log-rank; P = 0.009 by Fisher's exact for sensitivity analysis.
“P < 0.0005 by log-rank survival across all groups”
ResultsFind in source

Premise concern: surrogate not validated for clinical benefit; effect size not shown to be clinically meaningful.

INADEQUATESurrogate endpoint
The primary efficacy endpoint is time to meeting treatment criteria (parasitemia ≥500 parasites/μl or any parasitemia with clinical symptoms), which is a surrogate for clinical malaria. The paper does not provide evidence that this surrogate is validated as a reliable predictor of clinical outcomes such as severe disease or mortality, nor does it demonstrate target engagement at the tested dose beyond antibody titers. The claim of protection against ID challenge is based on this surrogate without establishing a link to clinical benefit.
“The prespecified primary endpoint was time to meeting treatment criteria (that is, reaching the parasitaemia threshold of 500 parasites μl −1 or any parasitaemia plus important clinical symptoms).”
Find in source
INADEQUATEEffect size
The primary reported effect is that 0/12 R21-vaccinated volunteers met the primary endpoint after ID challenge, compared to 5/5 after DVI challenge. While this is statistically significant, the effect size is presented as a binary outcome without anchoring to a clinically meaningful difference. The paper does not provide a minimal clinically important difference or a comparison to a clinically relevant threshold. The small sample size (n=5 for DVI) further limits the interpretability of the effect size.
“none of the 12 volunteers vaccinated by R21 met the primary endpoint following challenge with ID PfSPZ... five of five R21 vaccinated volunteers receiving DVI sporozoites met the primary endpoint ( P < 0.0005 by log rank across all groups).”
Find in source

Data authenticity concerns

None found

An adversarial read for patterns associated with data that may not be genuine: results that look too clean, implausibly large effects, duplicated data or images, and methods that do not match the results reported.

Checked — nothing surfaced.

Reporting gaps

None found

Required detail the manuscript never states — study design, biological variables, ethics approval and consent, key resources, statistical reporting, data and code availability, and overall transparency.

Checked — nothing surfaced.

Eight Dimensions8 pass

The introduction cites prior vaccine efficacy trials (RTS,S/AS01, R21/Matrix-M), animal model evidence that dermal sporozoites are more readily blocked, and notes the lack of human CHMI studies comparing ID vs DVI. The hypothesis follows logically from this evidence. Limitations of prior research (e.g., noise from mixed inoculation routes in mosquito bites) are explicitly addressed.

Sub-criteria

prior work citedADEQUATE

premise rationaleADEQUATE

limitations addressedADEQUATE

Per reviewer (3) — the votes behind the verdict

PASSReviewer 1· 90% conf

The study clearly establishes its scientific premise, citing prior work on anti-CSP antibodies, animal models showing route-dependent protection, and the gap in human CHMI studies.

Evidence

“Furthermore, in animal models, dermal sporozoites are more readily blocked by anti-CSP antibodies compared to intravenous sporozoites”

Main, paragraph 1-3Find in source

“We therefore hypothesized that vaccine protection might vary according the route of inoculation (that is, ID versus DVI).”

Main, paragraph 3Find in source

“However, where sensitivity to the anti-CSP antibodies induced by vaccination may vary for ID and for intravenous sporozoites, then the mixture of inoculation routes in infectious mosquito bites introduces noise and precludes a definitive measurement of correlates of efficacy.”

Main, paragraph 4Find in source

PASSReviewer 2· 90% conf

The study clearly establishes its scientific premise, citing prior work on malaria vaccines, CHMI, and animal models suggesting route-dependent protection.

Evidence

“Two malaria vaccines have recently been licensed (that is, RTS,S/AS01 (ref. ) and R21/Matrix-M ), both of which induce immunity to the major antigen on the sporozoite surface, that is, the circumsporozoite protein (CSP).”

Main, paragraphs 1-4Find in source

“We therefore hypothesized that vaccine protection might vary according the route of inoculation (that is, ID versus DVI).”

Main, paragraph 4Find in source

Main, paragraph 5Find in source

PASSReviewer 3· 90% conf

The study clearly establishes its scientific premise with prior work and a logical hypothesis.

Evidence

Main, paragraph 1-3Find in source

“We therefore hypothesized that vaccine protection might vary according the route of inoculation (that is, ID versus DVI).”

Main, paragraph 3Find in source

“To our knowledge, there are no CHMI studies that compare anti-CSP antibodies against different routes of inoculation of sporozoites in human volunteers.”

Main, paragraph 3Find in source

Randomization used a computer-generated sequence by an independent statistician, with allocation concealed via REDCap. Inclusion/exclusion criteria are detailed. A power analysis is provided. Blinding was not used (open-label) with a rationale: placebo impractical and outcomes based on objective PCR with laboratory team blinded. For a human RCT, replicate_distinction, controls, and independent_replication are not applicable. Outlier handling is addressed via ITT and per-protocol populations.

Sub-criteria

controlsN/A

power analysisADEQUATE

blinding levelsADEQUATE

outlier handlingADEQUATE

randomization unitADEQUATE

inclusion exclusionADEQUATE

randomization methodADEQUATE

replicate distinctionN/A

independent replicationN/A

Per reviewer (3) — the votes behind the verdict

PASSReviewer 1· 85% conf

The randomized controlled trial design is adequately described, including randomization method, inclusion/exclusion criteria, and power analysis, though blinding was not feasible (open-label) with a stated rationale.

Evidence

“The volunteers were randomly assigned with randomization via a computer-generated sequence by an independent statistician.”

MethodsFind in source

“Using a comparison of proportions and assuming P = 0.05 and 100% infection rates in the control group, we predicted 90% power to detect 40% efficacy with n = 20 groups and 80% power to detect 60% efficacy with n = 10.”

Statistical analysisFind in source

“The study was open label as (1) placebo for the different doses and routes would have been impractical and (2) outcomes were based on objective PCR data and the laboratory team were blind to allocations.”

MethodsFind in source

WARNReviewer 2· 85% conf

The study is a randomized controlled trial with adequate randomization and inclusion/exclusion criteria, but lacks blinding (open-label) and has a small sample size with no formal power calculation for the primary comparison.

Evidence

“The volunteers were randomly assigned with randomization via a computer-generated sequence by an independent statistician.”

MethodsFind in source

Statistical analysisFind in source

PASSReviewer 3· 85% conf

The trial design is adequately described with randomization, blinding rationale, power analysis, and inclusion/exclusion criteria.

Evidence

“The volunteers were randomly assigned with randomization via a computer-generated sequence by an independent statistician.”

MethodsFind in source

Statistical analysisFind in source

Sex is reported (70% male), age (mean 28.3 years), and health status (inclusion/exclusion criteria). Demographics include ethnicity (Mijikenda). For a human study, species/strain and housing conditions are not applicable. Sex justification is not applicable since both sexes were enrolled.

Sub-criteria

demographicsADEQUATE

sex reportedADEQUATE

sex justifiedN/A

age weight healthADEQUATE

housing conditionsN/A

species strain sourceN/A

Per reviewer (3) — the votes behind the verdict

PASSReviewer 1· 90% conf

Sex, age, and health status are reported for the human participants; demographics are adequately described.

Evidence

“There was a predominance of young male volunteers (28/40, 70%) with a mean age of 28.3 years”

ResultsFind in source

“Volunteers were from the Mijikenda ethnic group.”

ResultsFind in source

PASSReviewer 2· 90% conf

Demographic and baseline characteristics are reported, including age, sex, BMI, and ethnicity. Sex is reported, and the predominance of males is noted with a reference to gender roles.

Evidence

“Age in years, mean (s.d.) | 28.2 (6.1) | 26.1 (4.1) | 28.8 (5.1) | 30.8 (8.1) | 27.4 (6.8) | 25.4 (6.0) | 28.1 (7.1) | 26.7 (3.5) | 28.0 (8.0)”

Table 1Find in source

“Male, % ( n / N ) | 83.3% (10/12) | 71.4% (5/7) | 66.7% (8/12) | 55.6% (5/9) | 83.3% (10/12) | 71.4% (5/7) | 58.3% (7/12) | 77.8% (7/9) | 79% (27/34)”

Table 1Find in source

“The male predominance among volunteers appears to relate to established gender roles .”

ResultsFind in source

PASSReviewer 3· 90% conf

Biological variables are adequately reported for a human trial.

Evidence

“Male, % ( n / N ) | 83.3% (10/12) | 71.4% (5/7) | 66.7% (8/12) | 55.6% (5/9) | 83.3% (10/12) | 71.4% (5/7) | 58.3% (7/12) | 77.8% (7/9) | 79% (27/34)”

Table 1Find in source

“Volunteers were from the Mijikenda ethnic group.”

ResultsFind in source

The paper names the Kenyan National IRB (ERU (KEMRI/SERU/CGMR-C/158/3844)) and Oxford IRB (OxTREC (OxTREC 32-19)), and the Pharmacy and Poisons Board. Informed consent is described (written informed consent). Regulatory compliance is stated (ICH-GCP, FDA IND).

Sub-criteria

iacuc statementN/A

informed consentADEQUATE

irb ethics statementADEQUATE

regulatory complianceADEQUATE

Per reviewer (3) — the votes behind the verdict

PASSReviewer 1· 95% conf

Ethical approvals from named IRBs and regulatory bodies are reported, along with informed consent and regulatory compliance.

Evidence

“approvals were obtained from a National IRB in Kenya and the relevant Oxford IRB (ERU (KEMRI/SERU/CGMR-C/158/3844) and OxTREC (OxTREC 32-19))”

MethodsFind in source

“Following written informed consent, we recruited healthy adult men and women”

MethodsFind in source

“The use of Sanaria PfSPZ challenge (NF54) was done in accordance with an investigational new drugs application with the US Food and Drug Administration.”

MethodsFind in source

PASSReviewer 2· 95% conf

Ethical approvals from named IRBs and regulatory bodies are reported, and informed consent is described.

Evidence

“Before commencing activity, approvals were obtained from a National IRB in Kenya and the relevant Oxford IRB (ERU (KEMRI/SERU/CGMR-C/158/3844) and OxTREC (OxTREC 32-19)) and from the medicines regulatory authority in Kenya (Pharmacy and Poisons Board (ECCT/19/11/01)).”

MethodsFind in source

“Following written informed consent, we recruited healthy adult men and women aged between 18 and 45 years from Kilifi North on the Kenyan Coast”

MethodsFind in source

“The use of Sanaria PfSPZ challenge (NF54) was done in accordance with an investigational new drugs application with the US Food and Drug Administration.”

MethodsFind in source

PASSReviewer 3· 95% conf

Ethical approvals and consent are adequately documented.

Evidence

MethodsFind in source

“Following written informed consent, we recruited healthy adult men and women aged between 18 and 45 years from Kilifi North on the Kenyan Coast”

MethodsFind in source

R21/Matrix-M is described with dose (10 μg mixed with Matrix-M 50 μg). ChAd63/MVA ME-TRAP is described. PfSPZ challenge (Sanaria) is identified with doses. Software (STATA, REDCap, SeekDeep) is identified with versions where applicable. Bench criteria (antibodies, cell lines, mycoplasma, organisms) are not applicable as this is a clinical trial without wet-lab assays.

Sub-criteria

mycoplasma testingN/A

reagents identifiedADEQUATE

organisms identifiedN/A

antibodies identifiedN/A

cell line authenticationN/A

software tools identifiedADEQUATE

Per reviewer (3) — the votes behind the verdict

PASSReviewer 1· 85% conf

The investigational products (R21/Matrix-M, ChAd63/MVA ME-TRAP, PfSPZ challenge) are identified with manufacturer and dose; software tools are identified.

Evidence

“R21 was thawed to room temperature then mixed with Matrix-M before administration (10 μg mixed with Matrix-M 50 μg)”

MethodsFind in source

paraphrase[Methods, CHMI]

“we used P. falciparum NF54 sporozoites (Sanaria PfSPZ challenge (NF54)) using two alternative inoculation routes: injecting either 22,500 PfSPZ challenge ID or 3,200 PfSPZ challenge DVI.”

“A randomization list in the form of password protected spreadsheet was generated using STATA and the data manager setup randomization in REDCap.”

MethodsFind in source

PASSReviewer 2· 85% conf

The investigational products (R21/Matrix-M, ChAd63/MVA ME-TRAP, PfSPZ Challenge) are identified with manufacturer and dose, and key reagents and software are described.

Evidence

“R21 was thawed to room temperature then mixed with Matrix-M before administration (10 μg mixed with Matrix-M 50 μg) and administered intramuscularly.”

MethodsFind in source

“The CHMI agent (that is, Sanaria PfSPZ challenge (NF54)) in cryovials was thawed by partial submersion of each vial for 30 s in a 37 ± 1 °C water bath.”

MethodsFind in source

“A randomization list in the form of password protected spreadsheet was generated using STATA and the data manager setup randomization in REDCap.”

Statistical analysisFind in source

PASSReviewer 3· 85% conf

Key resources, including the investigational product and software, are adequately identified.

Evidence

“R21 was thawed to room temperature then mixed with Matrix-M before administration (10 μg mixed with Matrix-M 50 μg) and administered intramuscularly.”

MethodsFind in source

“18S Pf forward-5′GTAATTGGAATGATAGGAATTTACAAGGT 3′; 18S Pf Reverse-5’ TCAACTACGAACGTTTTAACTGCAAC 3′; 18S Pf MGB -5′ FAM- AACAATTGGAGGGCAAG-NFQ-MGB 3′”

MethodsFind in source

“Sequence data analysis was performed in SeekDeep version 3.0.110”

MethodsFind in source

Tests named include log-rank, Fisher's exact, Kruskal-Wallis. Effect sizes with CIs are reported (e.g., geometric means with 95% CI). Exact p-values are given (e.g., P < 0.0005, P = 0.14). Software (STATA) is identified. Data presentation includes Kaplan-Meier curves and per-group n. Mathematical plausibility is not applicable for large-N continuous outcomes; however, some subgroup counts in Table 2 show a potential inconsistency (see integrity concerns).

Sub-criteria

tests namedADEQUATE

exact p valuesADEQUATE

effect sizes ciADEQUATE

data presentationADEQUATE

software identifiedADEQUATE

assumptions verifiedADEQUATE

mathematical plausibilityN/A

Per reviewer (3) — the votes behind the verdict

PASSReviewer 1· 80% conf

Statistical tests are named, effect sizes with CIs are reported, and data presentation is adequate for a clinical trial; exact p-values are reported for key comparisons.

Evidence

“P < 0.0005 by log-rank survival across all groups”

ResultsFind in source

“increased from geometric mean of 104 s.f.u. (95% CI 70–153) at baseline to a peak of 735 (95% CI 364–1,485 s.f.u., P = 0.01”

ResultsFind in source

“P < 0.0005 by log rank across all groups”

AbstractFind in source

WARNReviewer 2· 80% conf

Statistical tests are named (log-rank, Fisher's exact, Kruskal-Wallis), and effect sizes with CIs are reported for some outcomes, but exact p-values are often reported as thresholds (e.g., P < 0.0005) and some analyses lack CIs.

Evidence

“P < 0.0005 by log-rank survival across all groups”

ResultsFind in source

“P < 0.0005 by log-rank testing across all groups.”

ResultsFind in source

“Peak responses were geometric means of 2,152 and 1,113 and minimum to maximum ranges of 750–5,500 versus 610–3,300 for ID versus DVI challenged groups, respectively ( P = 0.14).”

ResultsFind in source

PASSReviewer 3· 80% conf

Statistical methods are adequately reported, with named tests, effect sizes with CIs, and software identified.

Evidence

“P < 0.0005 by log-rank survival across all groups”

ResultsFind in source

“spot-forming units (s.f.u.) per million peripheral blood mononuclear cells (PBMCs) increased from geometric mean of 104 s.f.u. (95% CI 70–153) at baseline to a peak of 735 (95% CI 364–1,485 s.f.u., P = 0.01”

ResultsFind in source

“A randomization list in the form of password protected spreadsheet was generated using STATA”

Statistical analysisFind in source

Data are deposited in Harvard Dataverse (DOI 10.7910/DVN/TNHS14). Individual-level data are available via application to the Data Governance Committee with contact email and no timing restrictions. This is reported_and_adequate. Repository deposit and accession numbers are not applicable for identifiable patient data, but the Dataverse deposit covers non-identifiable data. Code sharing is not applicable as no bespoke code is mentioned.

Sub-criteria

code sharingN/A

accession numbersN/A

repository depositADEQUATE

data availability statementADEQUATE

Per reviewer (3) — the votes behind the verdict

PASSReviewer 1· 90% conf

Data availability statement is concrete, with a repository DOI and a managed-access procedure for individual-level data.

Evidence

“Data are available through the online repository for KEMRI–Wellcome Trust Research Programme: Harvard Dataverse at 10.7910/DVN/TNHS14 (ref. ). Individual-level data, excluding personal identifiers, will be made available in accordance with an application to the Data Governance Committee, which meets monthly (dgc@kemri-wellcome.org).”

Data availabilityFind in source

PASSReviewer 2· 90% conf

A data availability statement is present, with data deposited in Harvard Dataverse and a managed access procedure via a Data Governance Committee.

Evidence

Data availabilityFind in source

PASSReviewer 3· 90% conf

Data availability is adequately described with a concrete repository and managed access procedure.

Evidence

“Data are available through the online repository for KEMRI–Wellcome Trust Research Programme: Harvard Dataverse at 10.7910/DVN/TNHS14 (ref. ).”

Data availabilityFind in source

“Individual-level data, excluding personal identifiers, will be made available in accordance with an application to the Data Governance Committee, which meets monthly (dgc@kemri-wellcome.org).”

Data availabilityFind in source

Methods are comprehensive. Trial registration numbers are provided (NCT03947190, PACTR202108505632810). Limitations are explicitly discussed (historical controls, sample size). Conclusions are proportional, acknowledging small sample size. Funding and competing interests are stated. Reporting guideline (CONSORT) is implied via CONSORT diagram, though not explicitly referenced.

Sub-criteria

funding coiADEQUATE

trial registrationADEQUATE

reporting guidelineINADEQUATE

methods completenessADEQUATE

all outcomes reportedADEQUATE

limitations discussedADEQUATE

conclusions proportionalADEQUATE

Per reviewer (3) — the votes behind the verdict

PASSReviewer 1· 90% conf

Methods are detailed, trial is registered, limitations are discussed, conclusions are proportional, and funding/COI are disclosed.

Evidence

“The study was registered with ClinicalTrials.gov ( NCT03947190 (https://clinicaltrials.gov/study/NCT03947190?term=NCT03947190&rank=1) ) and PACTR ( PACTR202108505632810 (https://pactr.samrc.ac.za/TrialDisplay.aspx?TrialID=15911) ).”

AbstractFind in source

“Our study has some limitations. We relied on historical controls for PfSPZ challenge by DVI”

DiscussionFind in source

“This work was supported by a Wellcome (203077) to P.B. as the lead applicant.”

AcknowledgementsFind in source

PASSReviewer 2· 85% conf

The study is registered, methods are detailed, limitations are discussed, and funding/COI are disclosed. A reporting guideline is not explicitly mentioned, but the paper follows CONSORT-like reporting with a flow diagram.

Evidence

AbstractFind in source

“Our study has some limitations. We relied on historical controls for PfSPZ challenge by DVI and prior malaria exposure appears to have been higher in this group”

DiscussionFind in source

“This work was supported by a Wellcome (203077) to P.B. as the lead applicant.”

AcknowledgementsFind in source

PASSReviewer 3· 90% conf

Reporting is transparent with trial registration, reporting summary, limitations, and funding/COI statements.

Evidence

AbstractFind in source

“Our study has some limitations. We relied on historical controls for PfSPZ challenge by DVI and prior malaria exposure appears to have been higher in this group”

DiscussionFind in source

“This work was supported by a Wellcome (203077) to P.B. as the lead applicant.”

AcknowledgementsFind in source

Registered (1 ID: ClinicalTrials.gov). Reporting guideline cited: CONSORT.

ClinicalTrials.gov

NCT03947190

Reporting guidelines: CONSORT

Broken references and links

1 finding · worst low

References checked against Crossref, OpenAlex and Retraction Watch for retractions and resolvability, plus declared data and code links probed for whether they resolve to content matching the paper.

References not resolvable to a published paperRecomputed

Checked 43 references by DOI: 2 verified — 1 DOI unresolved, 40 no DOI (shown, not verified).

UNRESOLVED10.7910/dvn/tnhs14
Replication data for: The malaria vaccine R21 is protective against intradermal but not intravenous Plasmodium falciparum sporozoites in controlled human malaria infection in Kenyan adults
Cited DOI does not resolve to any Crossref record.
NO DOI
Safety and efficacy of malaria vaccine candidate R21/Matrix-M in African children: a multicentre, double-blind, randomised, phase 3 trial
No DOI in the reference — shown for manual review; not independently verifiable (not a fabrication signal).
NO DOI
Subcutaneous administration of a monoclonal antibody to prevent malaria
No DOI in the reference — shown for manual review; not independently verifiable (not a fabrication signal).
NO DOI
Public health impact and cost-effectiveness of the RTS,S/AS01 malaria vaccine: a systematic comparison of predictions from four mathematical models
No DOI in the reference — shown for manual review; not independently verifiable (not a fabrication signal).
NO DOI
First results of phase 3 trial of RTS,S/AS01 malaria vaccine in African children
No DOI in the reference — shown for manual review; not independently verifiable (not a fabrication signal).
NO DOI
Seven-year efficacy of RTS,S/AS01 malaria vaccine among young African children
No DOI in the reference — shown for manual review; not independently verifiable (not a fabrication signal).
NO DOI
Duration of vaccine efficacy against malaria: 5th year of follow-up in children vaccinated with RTS,S/AS02 in Mozambique
No DOI in the reference — shown for manual review; not independently verifiable (not a fabrication signal).
NO DOI
Efficacy and immunogenicity of R21/Matrix-M vaccine against clinical malaria after 2 years’ follow-up in children in Burkina Faso: a phase 1/2b randomised controlled trial
No DOI in the reference — shown for manual review; not independently verifiable (not a fabrication signal).
NO DOI
Further analysis of correlates of protection from a phase 2a trial of the falciparum malaria vaccines RTS,S/AS01B and RTS,S/AS02A in malaria-naive adults
No DOI in the reference — shown for manual review; not independently verifiable (not a fabrication signal).
NO DOI
Controlled human malaria infection studies in Africa—past, present, and future
No DOI in the reference — shown for manual review; not independently verifiable (not a fabrication signal).
NO DOI
Analysis of immunity to febrile malaria in children that distinguishes immunity from lack of exposure
No DOI in the reference — shown for manual review; not independently verifiable (not a fabrication signal).
NO DOI
Randomized, double-blind, phase 2a trial of falciparum malaria vaccines RTS,S/AS01B and RTS,S/AS02A in malaria-naive adults: safety, efficacy, and immunologic associates of protection
No DOI in the reference — shown for manual review; not independently verifiable (not a fabrication signal).
NO DOI
R21 in Matrix-M adjuvant in UK malaria-naive adult men and non-pregnant women aged 18–45 years: an open-label, partially blinded, phase 1–2a controlled human malaria infection study
No DOI in the reference — shown for manual review; not independently verifiable (not a fabrication signal).
NO DOI
Feeding behaviour and sporozoite ejection by infected Anopheles stephensi
No DOI in the reference — shown for manual review; not independently verifiable (not a fabrication signal).
NO DOI
Controlled human malaria infection of Tanzanians by intradermal injection of aseptic, purified, cryopreserved Plasmodium falciparum sporozoites
No DOI in the reference — shown for manual review; not independently verifiable (not a fabrication signal).
NO DOI
Direct venous inoculation of Plasmodium falciparum sporozoites for controlled human malaria infection: a dose-finding trial in two centres
No DOI in the reference — shown for manual review; not independently verifiable (not a fabrication signal).
NO DOI
Longitudinal analysis of Plasmodium sporozoite motility in the dermis reveals component of blood vessel recognition
No DOI in the reference — shown for manual review; not independently verifiable (not a fabrication signal).
NO DOI
Antibody-mediated protection against Plasmodium sporozoites begins at the dermal inoculation site
No DOI in the reference — shown for manual review; not independently verifiable (not a fabrication signal).
NO DOI
Cytotoxic anti-circumsporozoite antibodies target malaria sporozoites in the host skin
No DOI in the reference — shown for manual review; not independently verifiable (not a fabrication signal).
NO DOI
Translating the Immunogenicity of prime-boost immunization with ChAd63 and MVA ME-TRAP from malaria naive to malaria-endemic populations
No DOI in the reference — shown for manual review; not independently verifiable (not a fabrication signal).
NO DOI
Evaluation of the efficacy of ChAd63-MVA vectored vaccines expressing circumsporozoite protein and ME-TRAP against controlled human malaria infection in malaria-naive individuals
No DOI in the reference — shown for manual review; not independently verifiable (not a fabrication signal).
NO DOI
First field efficacy trial of the ChAd63 MVA ME-TRAP vectored malaria vaccine candidate in 5–17 months old infants and children
No DOI in the reference — shown for manual review; not independently verifiable (not a fabrication signal).
NO DOI
Prime-boost vaccination with chimpanzee adenovirus and modified vaccinia Ankara encoding TRAP provides partial protection against Plasmodium falciparum infection in Kenyan adults
No DOI in the reference — shown for manual review; not independently verifiable (not a fabrication signal).
NO DOI
Controlled human malaria infection studies: insights into recent advances and key immunological and ethical implementation lessons
No DOI in the reference — shown for manual review; not independently verifiable (not a fabrication signal).
NO DOI
Ethical considerations in controlled human malaria infection studies in low resource settings: experiences and perceptions of study participants in a malaria challenge study in Kenya
No DOI in the reference — shown for manual review; not independently verifiable (not a fabrication signal).
NO DOI
Safety and PCR monitoring in 161 semi-immune Kenyan adults following controlled human malaria infection
No DOI in the reference — shown for manual review; not independently verifiable (not a fabrication signal).
NO DOI
Four-year efficacy of RTS,S/AS01E and its interaction with malaria exposure
No DOI in the reference — shown for manual review; not independently verifiable (not a fabrication signal).
NO DOI
Correlates of protection induced by vÿaccination
No DOI in the reference — shown for manual review; not independently verifiable (not a fabrication signal).
NO DOI
Immunogenicity and safety of fractional doses of 17D-213 yellow fever vaccine in children (YEFE): a randomised, double-blind, non-inferiority substudy of a phase 4 trial
No DOI in the reference — shown for manual review; not independently verifiable (not a fabrication signal).
NO DOI
Fractional doses of pneumococcal conjugate vaccine—a noninferiority Trial
No DOI in the reference — shown for manual review; not independently verifiable (not a fabrication signal).
NO DOI
Immunogenicity and safety of a meningococcal A conjugate vaccine in Africans
No DOI in the reference — shown for manual review; not independently verifiable (not a fabrication signal).
NO DOI
Long-term immunogenicity of hepatitis B vaccination and policy for booster: an Italian multicentre study
No DOI in the reference — shown for manual review; not independently verifiable (not a fabrication signal).
NO DOI
Cytotoxicity of human antibodies targeting the circumsporozoite protein is amplified by 3D substrate and correlates with protection
No DOI in the reference — shown for manual review; not independently verifiable (not a fabrication signal).
NO DOI
Inability of malaria vaccine to induce antibodies to a protective epitope within its sequence
No DOI in the reference — shown for manual review; not independently verifiable (not a fabrication signal).
NO DOI
The induction and persistence of T cell IFN-γ responses after vaccination or natural exposure is suppressed by Plasmodium falciparum
No DOI in the reference — shown for manual review; not independently verifiable (not a fabrication signal).
NO DOI
Translating the immunogenicity of prime-boost immunization with ChAd63 and MVA METRAP from malaria naive to malaria-endemic populations
No DOI in the reference — shown for manual review; not independently verifiable (not a fabrication signal).
NO DOI
Relationship between exposure, clinical malaria, and age in an area of changing transmission intensity
No DOI in the reference — shown for manual review; not independently verifiable (not a fabrication signal).
NO DOI
Controlled human malaria infection (CHMI) outcomes in Kenyan adults is associated with prior history of malaria exposure and anti-schizont antibody response
No DOI in the reference — shown for manual review; not independently verifiable (not a fabrication signal).
NO DOI
Safety and immunogenicity of varied doses of R21/Matrix-MTM vaccine at three years follow-up: a phase 1b age de-escalation, dose-escalation trial in adults, children, and infants in Kilifi-Kenya
No DOI in the reference — shown for manual review; not independently verifiable (not a fabrication signal).
NO DOI
Quantification of Plasmodium falciparum : validation of quantitative polymerase chain reaction assays for detection of parasites in controlled human malaria infection studies
No DOI in the reference — shown for manual review; not independently verifiable (not a fabrication signal).
NO DOI
Targeted amplicon deep sequencing of ama1 and mdr1 to track within-host P. falciparum diversity throughout treatment in a clinical drug trial
No DOI in the reference — shown for manual review; not independently verifiable (not a fabrication signal).

2 data/code links checked; 2 live.

datahttps://clinicaltrials.gov/study/NCT03947190?term=NCT03947190&rank=1LIVEHTTP 200
Resolves, but the content could not be matched to the paper.
datahttps://pactr.samrc.ac.za/TrialDisplay.aspx?TrialID=15911LIVEHTTP 200
Resolves, but the content could not be matched to the paper.

Copyediting

9 minor

Wording, consistency and formatting errors that need correcting before submission.

No major wording or formatting errors. 9 minor suggestions below.

9 copyedit issues flagged: mostly consistency, typo, grammar.

MINORtypoAbstract
“R21/Matrix-M was highly protective against CHMI using ID. inoculation of sporozoites”
→ Remove the period after 'ID' to fix the sentence break.
Typographical error splitting a sentence.
MINORconsistencyTable 2
“Treated, nonfebrile, % ( n / N ) | 0% (0/12) for R21 DVI”
→ Change to 0% (0/5) to match the group n=5.
Denominator inconsistency in Table 2.
MINORtypoMethods, Statistical analysis
“Sstatistical analysis plan”
→ Change to 'Statistical analysis plan'.
Typo in supplementary information description.
MINORconsistencyResults, Secondary outcomes
“127 s.f.u. (95% CI 74–409 s.f.u.) among the control group; P = 0.064, P = 0.001 and P = 0.084”
→ Verify the p-values and CIs are consistent with the Extended Data Fig. 2 caption.
Potential inconsistency in reported p-values between text and figure caption.
MINORtypoAbstract
“R21/Matrix-M was highly protective against CHMI using ID. inoculation of sporozoites”
→ Remove the period after 'ID'.
Typographical error.
MINORconsistencyTable 2
“Treated, nonfebrile, % ( n / N ) | 37.5% (3/8) | 0% (0/12) | 17% (2/12) | 35.3% (12/34) | 0% (0/12)”
→ The last column shows '0% (0/12)' but the group is R21 DVI n=5; should be '0% (0/5)'.
Inconsistent denominator in table.
MINORconsistencyExtended Data Fig. 2
“compared with 127 sfu (95%CI 174 sfu (95%CI 74-409) among the control group”
→ Remove the duplicated '95%CI 174 sfu'.
Copy-paste error.
MINORgrammarMain, paragraph 4
“We therefore hypothesized that vaccine protection might vary according the route of inoculation”
→ Change 'according' to 'according to'.
Missing preposition.
MINORclarityMethods, Statistical analysis
“The intent-to-treat (ITT) cohort included volunteers receiving one or more vaccines.”
→ Clarify whether ITT includes all randomized or only those who received at least one dose.
Definition of ITT could be more precise.

Kaimen Rigor Action ItemsFinal pass before journal submission

The published work is generally robust, but an informed reader should weigh the small DVI R21 group (n=5) and the power analysis mismatch when interpreting the primary conclusion. The threshold-only p-values and the Table 2 denominator inconsistency warrant attention; a correction or erratum for the Table 2 issue is advisable.

1.
HIGHrigor
Correct the Table 2 denominator for the 'Treated, nonfebrile' row for R21 DVI: change '0% (0/12)' to '0% (0/5)' to match the group size n=5.
The current denominator is internally inconsistent and could mislead readers about the group size.
2.
HIGHstatistics
Provide a formal power calculation that matches the actual group sizes and primary comparison (ID vs DVI in R21 vaccinees), or explicitly state that the study was not powered for this comparison.
The reported power analysis (n=20 or n=10 per group) does not match the actual group sizes (n=5-12), undermining the stated power.
3.
HIGHstatistics
Report exact p-values (e.g., P=0.0003) instead of thresholds like P<0.0005 in the results and figures, or state that exact values are unavailable due to software output.
Threshold-only p-values are imprecise and reduce the informativeness of the statistical reporting.
4.
HIGHstatistics
Report confidence intervals for the primary efficacy estimates (e.g., 95% CI for the difference in proportions) to complement the p-values.
Effect sizes with CIs are reported for immunogenicity but not for the primary efficacy outcomes, limiting interpretation.
5.
HIGHreporting
Explicitly name the reporting guideline followed (e.g., CONSORT) in the methods or a checklist, even though the flow diagram is included.
The CONSORT flow diagram is present but the guideline is not explicitly referenced, which is a reporting gap.
6.
HIGHstatistics
Clarify the assumptions of the log-rank test (e.g., proportional hazards) and whether they were verified.
The assumptions are not explicitly stated or verified, which is important for the primary analysis.
7.
MEDIUMreporting
Add a statement on whether the statistical analysis plan was pre-specified and adhered to, to enhance transparency.
This would clarify the confirmatory vs exploratory nature of the analyses.
8.
MEDIUMreporting
Add a note on the handling of missing data or protocol deviations in the statistical analysis section.
The ITT definition is mentioned but the handling of missing data is not described.
9.
MEDIUMdata code
Add a statement about code availability if any custom analysis code was used, or clarify that no custom code was developed.
This would facilitate reproducibility, though not strictly required for a clinical trial.
10.
MEDIUMreporting
In the discussion, further address the potential impact of the small DVI R21 group (n=5) on the robustness of the primary conclusion.
The small group size is a key limitation that should be explicitly weighed in the interpretation.
11.
MEDIUMcopyedit
Fix the typo in the Abstract: remove the period after 'ID' in 'ID. inoculation of sporozoites'.
This is a clear typographical error that splits a sentence.
12.
MEDIUMcopyedit
Fix the grammar in Main paragraph 4: change 'according the route' to 'according to the route'.
Missing preposition is a grammatical error.
13.
MEDIUMcopyedit
Fix the typo in Methods, Statistical analysis: change 'Sstatistical analysis plan' to 'Statistical analysis plan'.
Obvious typo in the supplementary information description.
14.
MEDIUMcopyedit
Fix the copy-paste error in Extended Data Fig. 2: remove the duplicated '95%CI 174 sfu'.
The duplicated text is a clear error that could confuse readers.
15.
MEDIUMcopyedit
Verify the p-values and CIs in Results, Secondary outcomes are consistent with the Extended Data Fig. 2 caption.
There is a potential inconsistency in reported p-values between text and figure caption.
16.
LOWreporting
Clarify the definition of the ITT cohort in Methods, Statistical analysis: specify whether it includes all randomized or only those who received at least one dose.
The current definition is ambiguous and could affect interpretation of the analysis population.
17.
LOWdata code
In the data availability statement, specify the conditions for data access more concretely (e.g., review process, timeline) beyond the committee contact.
This would improve transparency and facilitate data sharing.
18.
LOWother
Verify the reference for the replication data (DOI 10.7910/DVN/TNHS14) as it was not found in the registry.
The citation component flagged this reference as not found; it may be a fabrication or an error that should be corrected.

Full text (55,132 chars)Analyzed: Aug 15, 2026

RigorReviewer 1

RigorReviewer 2

RigorReviewer 3

RigorPre-Submission Reviewer

CopyeditAgent Scribe

CitationsCitation Integrity

StatisticsStatistics Consistency

ReproducibilityLink verification (liveness + content)· no model (rule-based)

PreregistrationDeterministic check· no model (rule-based)

The star rating is the report’s one-glance summary. Every paper starts at 5★ and loses stars for the concrete problems the review finds — so a rating is never a vague average, it’s a running total you can read line by line under “How this rating was calculated.”

How stars are deducted

Reporting — 8 dimensionseach dimension that fully fails−½★
each dimension partially met−¼★
Statistics · Integrity · Claimseach serious problem−1★
each medium problem−½★
Citationseach retracted or unverifiable reference−¼★
Copyeditonly when the manuscript needs a full edit−½★

The rating never drops below 1★, and a demonstrable critical failure (an impossible statistic, a proven ethics violation) caps it at 1★ on its own — so the stars can never look healthy when the verdict is CRITICAL.

The rating draws on a panel of agents. Three independent Kaimen Rigor reviewers grade the eight dimensions below across several independent passes (the shown verdict is their majority vote — steadier than any single run), isolate the paper’s major claims and check its own evidence backs them, and flag integrity concerns. Alongside them, a citation agent resolves every reference against Crossref, OpenAlex, and Retraction Watch; a statistics agent recomputes reported tests; and rule-based checks verify that declared data/code links actually resolve. Full text is required — an abstract-only submission is not analyzed.

The eight reporting dimensions

Scientific PremisePrior work, rationale, and how it addresses gaps.

Study Design & RigorRandomization, blinding, power, controls, replication.

Biological VariablesSex, age, species/strain, housing, demographics.

Ethical ApprovalsIRB/IACUC approval, informed consent, regulatory compliance.

Key ResourcesAntibodies, cell lines, organisms, software — identified with persistent IDs.

Statistical ReportingNamed tests, exact p-values, effect sizes, plausible summary stats.

Data & Code AvailabilityAvailability statements, repositories, accession numbers, shared code.

Reporting TransparencyMethods, registration, guidelines, outcomes, limitations, funding/COI.

Graded against NIH, MDAR, ARRIVE 2.0, CONSORT, EQUATOR, and RRID guidelines. A dimension that doesn’t apply to the study type is skipped, never penalized.

This Kaimen Rigor review is model-assisted and is not a substitute for formal expert review. It complements human evaluation by surfacing potential methodological concerns — verify each finding against the source.

Malaria vaccine protection against intradermal or venous parasites: a randomized phase 2b human challenge trial.

DOI

10.1038/s41591-025-04107-6

Record issued

2026-08-15

Engine

7.39.0

Exported

2026-09-20