Verified Rigor RecordRigor Reviewed

Rigor-Reviewed Manuscript

circRNA_100290 plays a role in oral cancer by functioning as a sponge of the miR-29 family · 10.1038/onc.2017.89

Name: Verified Rigor Record — circRNA_100290 plays a role in oral cancer by functioning as a sponge of the miR-29 family · 10.1038/onc.2017.89
Item: circRNA_100290 plays a role in oral cancer by functioning as a sponge of the miR-29 family · 10.1038/onc.2017.89
Rating: 71
Author: Αlpha¹

Paper source

Αlpha¹ Editorial

This rigor review was examined and confirmed by Αlpha¹ Editorial · July 6, 2026

Αlpha¹ Rigor Review

Rigor Reviewed

WARN

Warnings to address · Observational Study

Eight dimensions — click a segment for details

Critical

High-priority

Model-reported confidence: highReviewer agreement: moderateEngine: 7.5.0Source: full text

Not verified in this report

No reported statistical tests were found to recompute.

This Αlpha¹ Rigor Review uses AI Rigor Reviewers trained on a curated corpus of high-fidelity and retracted papers, with expert supervision and curation. It can still make mistakes; verify each finding against the source before relying on it.

The paper presents a plausible and well-motivated study of circRNA_100290 as a ceRNA in OSCC, with detailed methods. However, several critical rigor elements are missing: no data/code availability, no randomization/blinding, no power analysis, incomplete ethical reporting, and insufficient statistical reporting. The paper also contains a likely arithmetic error in a key calculation and an overstated therapeutic claim.

All 8 dimensions were applicable. The three independent rigor evaluations converged well (all pass/warn/fail same except ethical approvals and data code availability where one reviewer diverged slightly). The statistics verifier found no recomputable tests; the citation check found 3 references not found in registry (not retracted); an internal contradiction was noted in the ΔΔCt calculation.

12 major claims checked against the paper's own evidence: 1 not fully backed by the presented evidence (unsupported or overstated).

2 integrity concerns flagged (0 high).

Rigor

Eight Dimensions2 pass · 5 warn · 1 fail

12 major claims1 overstated2 partial9 supported

The introduction cites extensive prior work on miRNAs and lncRNAs in cancer, including OSCC, and notes that only three circRNAs have been confirmed to function through a ceRNA mechanism. It states 'the function of circRNAs in tumour initiation and progression is unclear' and 'there are currently no reports describing the role of circRNAs in OSCC', establishing a clear gap. The hypothesis that circRNA_100290 acts as a ceRNA sponge for the miR-29 family to regulate CDK6 is logically derived from the ceRNA framework. Limitations of prior studies (e.g., few circRNAs confirmed as sponges) are acknowledged. The study does not explicitly discuss how it addresses all weaknesses of prior work, but the premise is well-grounded.

Sub-criteria

prior work citedADEQUATE

premise rationaleADEQUATE

limitations addressedINADEQUATE

Per reviewer (3) — the votes behind the verdict

PASSReviewer 1· 90% conf

The premise is well-established with citations to prior work on circRNAs, ceRNA mechanisms, and OSCC, and the study addresses gaps by investigating circRNAs in OSCC.

Evidence

direct quote[Introduction, paragraph 3-4]

“Pandolfi et al., presented a hypothesis called the competing endogenous RNA (ceRNA) mechanism… while only three circRNAs, ciRs-7 (also termed CDR1as), Sry and circHIPK3 have thus far been confirmed to function through a ceRNA mechanism.”

direct quote[Introduction, paragraph 3]

“However, the function of circRNAs in tumour initiation and progression is unclear. Moreover, there are currently no reports describing the role of circRNAs in OSCC.”

direct quote[Introduction, paragraph 3]

“we can conclude that circRNA_100290 may act as a ceRNA to regulate CDK6 expression by decoying the miR-29b family.”

PASSReviewer 2· 90% conf

The scientific premise is clearly established: the function of circRNAs in OSCC is unknown, and the study builds on known ceRNA mechanisms.

Evidence

direct quote[Introduction, paragraph 2-3]

“Pandolfi et al., presented a hypothesis called the competing endogenous RNA (ceRNA) mechanism...”

direct quote[Introduction, paragraph 3]

“However, the function of circRNAs in tumour initiation and progression is unclear. Moreover, there are currently no reports describing the role of circRNAs in OSCC.”

paraphrase[Introduction, final paragraph]

“The study hypothesizes that circRNA_100290 acts as a ceRNA to regulate CDK6 by sponging miR-29 family members.”

PASSReviewer 3· 95% conf

The paper cites prior work on non-coding RNAs in cancer, establishes a logical rationale for studying circRNAs in OSCC, and acknowledges limitations of prior research.

Evidence

direct quote[Introduction, paragraph 4]

“However, there are very few such circRNAs that contain multiple MREs to decoy a particular miRNA.”

direct quote[Introduction, paragraph 5]

“However, the function of circRNAs in tumour initiation and progression is unclear. Moreover, there are currently no reports describing the role of circRNAs in OSCC.”

direct quote[Introduction, last sentence]

“we can conclude that circRNA_100290 may act as a ceRNA to regulate CDK6 expression by decoying the miR-29b family.”

The microarray comparison of OSCC vs NCMT uses 5 samples per group, but no randomization or blinding is reported. The in vivo experiment uses 3 mice per group without randomization or blinding. No power analysis is provided. Inclusion/exclusion criteria for tissue samples are partially described (patients had no prior surgery/radiotherapy/chemotherapy, but no detailed criteria). Outlier handling is not mentioned. Positive controls are not described for many assays. The in vivo experiment lacks independent replication. However, cell culture experiments use standard controls (e.g., si-circ vs si-linear, rescue with miR-29 inhibitor), and the study uses biological replicates (n=3 in some experiments).

Sub-criteria

controlsINADEQUATE

power analysisNOT REPORTED

blinding levelsNOT REPORTED

outlier handlingNOT REPORTED

randomization unitNOT REPORTED

inclusion exclusionINADEQUATE

randomization methodNOT REPORTED

replicate distinctionINADEQUATE

independent replicationNOT REPORTED

Per reviewer (3) — the votes behind the verdict

WARNReviewer 1· 85% conf

The design combines human tissue comparison with in vitro and in vivo experiments, but lacks explicit randomization, blinding, power analysis, and some other rigor elements.

Evidence

absence[Materials and methods]

No randomization or blinding is reported for any experiment.

absence[Materials and methods]

No power analysis is mentioned.

direct quote[Materials and methods, Tissue specimens]

“All of the patients enrolled in this study had not undergone previous surgery, radiotherapy and chemotherapy.”

WARNReviewer 2· 85% conf

Several design elements are missing or inadequately reported: no randomization or blinding for the in vivo experiment, no pre-specified sample-size calculation, and minimal handling of replicates.

Evidence

absence[Materials and methods, Tumour formation experiment]

No randomization or blinding method reported for in vivo experiment.

absence[Materials and methods]

No sample size or power analysis reported.

direct quote[Materials and methods, RNA interference and luciferase assay]

“For si-circRNA_100290, the sequence of the sense strand of the functional siRNA was 5′CUCAUGCUUAGGCUUGAUU dTdT3′...”

WARNReviewer 3· 85% conf

The study uses appropriate designs for discovery (microarray) and validation (cell lines, xenograft) but lacks pre-specification of inclusion/exclusion criteria, sample-size justification, blinding, and randomisation for the in vivo experiment.

Evidence

direct quote[Results, paragraph 'Effects of circRNA_100290 on cell cycle and cell proliferation']

“HN4 cell lines were implanted subcutaneously into the pectoral region of nude mice (three mice for negative control group, three mice for si-circRNA_100290 group and three mice for si-circRNA_100290+miR-29 inhibitor group).”

absence[Materials and methods]

No power analysis or sample-size justification is provided.

direct quote[Results, paragraph 'Knockdown of circRNA_100290 inhibits expression of CDK6']

“we co-transfected inhibitors of the miR-29 family and siRNA against circRNA_100290 into CAL27 and HN4 cell lines, and observed that the repression was reversed.”

Human tissue samples: sex, age, and health status of patients are not reported. The mouse experiment states mice are female, but no scientific justification is given for using only females. The mouse strain (BALB/C-nu/nu), age (5-week-old), and sex (female) are reported. Housing conditions for mice are not described. Demographics of human subjects (age, sex, race/ethnicity) are absent.

Sub-criteria

demographicsNOT REPORTED

sex reportedNOT REPORTED

sex justifiedN/A

age weight healthINADEQUATE

housing conditionsNOT REPORTED

species strain sourceADEQUATE

Per reviewer (3) — the votes behind the verdict

WARNReviewer 1· 80% conf

Sex, age, and health status of human subjects are not reported; mouse experiments use female mice but no justification for single-sex use; strain and source are reported.

Evidence

direct quote[Materials and methods, Tissue specimens]

“Tissue samples of OSCC and paired NCMT were obtained from patients who received surgical treatment at the Second Xiangya Hospital”

direct quote[Materials and methods, Tissue specimens]

“Tumour formation experiment in nude mice (BALB/C-nu/nu, female and 5-week-old)”

WARNReviewer 2· 80% conf

Sex, age, and strain are reported for nude mice but human tissue samples lack detailed demographics (age, sex, comorbidities).

Evidence

direct quote[Materials and methods, Tumour formation experiment]

“nude mice (BALB/C-nu/nu, female and 5-week-old)”

paraphrase[Materials and methods, Tissue specimens]

“Tissue samples from patients are described but no age, sex, or race are given.”

absence[Materials and methods]

Housing conditions for mice not described.

WARNReviewer 3· 80% conf

Species, strain, and source of cell lines and mice are reported, but sex of mice is stated only as 'female' without justification for single-sex use; age is given for mice but not for human tissue donors beyond 'patients'; health status and housing conditions for mice are partially reported.

Evidence

direct quote[Materials and methods, 'Tissue specimens']

“Tumour formation experiment in nude mice (BALB/C-nu/nu, female and 5-week-old)”

direct quote[Materials and methods, 'Tissue specimens']

“Tissue samples of OSCC and paired NCMT were obtained from patients who received surgical treatment at the Second Xiangya Hospital (Changsha, China).”

absence[Materials and methods]

No housing conditions described for mice.

The paper states ethics approval from the institutional review board of the Second Xiangya Hospital. Use of human tissues is covered by this approval, but informed consent is not explicitly mentioned. Animal experiments are conducted at Central South University experimental animal centre, but no separate IACUC statement or protocol number is provided. Regulatory compliance (Declaration of Helsinki, Guide for Care) is not explicitly stated, but the approval implies compliance.

Sub-criteria

iacuc statementNOT REPORTED

informed consentNOT REPORTED

irb ethics statementADEQUATE

regulatory complianceNOT REPORTED

Per reviewer (3) — the votes behind the verdict

PASSReviewer 1· 90% conf

The study reports IRB approval for human tissue use and animal ethics compliance, though no informed consent details are provided; given the tissue source, consent is likely implied but not explicitly stated.

Evidence

direct quote[Materials and methods, Tissue specimens]

“The study was approved by the institutional review board of the Second Xiangya Hospital of Central South University for scientific and ethical integrity.”

absence[Materials and methods, Tissue specimens]

Informed consent is not explicitly reported.

absence[Materials and methods, Tissue specimens]

No separate animal ethics approval statement.

WARNReviewer 2· 85% conf

Human study is approved by an IRB, and animal work is approved but the IACUC body is not explicitly named.

Evidence

direct quote[Materials and methods, Tissue specimens]

“The study was approved by the institutional review board of the Second Xiangya Hospital of Central South University for scientific and ethical integrity.”

absence[Materials and methods, Tissue specimens]

No informed consent statement for human tissue.

direct quote[Materials and methods, Tumour formation experiment]

“Tumour formation experiment in nude mice... was accomplished at experimental animal centre of Central South University.”

PASSReviewer 3· 90% conf

The study reports IRB approval from a named institution and states institutional animal ethics oversight; informed consent is not described for human tissue donors, but the oversight body approval is adequate for a non-interventional tissue study.

Evidence

direct quote[Materials and methods, 'Tissue specimens']

“The study was approved by the institutional review board of the Second Xiangya Hospital of Central South University for scientific and ethical integrity.”

absence[Materials and methods, 'Tissue specimens']

Informed consent for human tissues is not mentioned.

direct quote[Materials and methods, 'Tissue specimens']

“Tumour formation experiment in nude mice (BALB/C-nu/nu, female and 5-week-old) was accomplished at experimental animal centre of Central South University.”

Antibodies are identified (sc-7961, dilution 1:200, Santa Cruz) but validation data or specificity references are not provided. Cell lines are sourced from institutions but no STR authentication is reported; mycoplasma testing is not mentioned. The mouse strain is identified (BALB/C-nu/nu). Reagents are mostly identified (siRNAs from RiboBio, Lipofectamine 2000, etc.) but primer sequences are given. Software (Cytoscape, TargetScan, miRanda, RNA22) is named but versions are not provided. Arraystar home-made software is mentioned but not versioned.

Sub-criteria

mycoplasma testingNOT REPORTED

reagents identifiedINADEQUATE

organisms identifiedADEQUATE

antibodies identifiedINADEQUATE

cell line authenticationNOT REPORTED

software tools identifiedINADEQUATE

Per reviewer (3) — the votes behind the verdict

WARNReviewer 1· 85% conf

Antibodies are identified with catalog numbers and dilutions, but cell line authentication and mycoplasma testing are not reported; organism identification is adequate; software tools are named with vendors but not always versions.

Evidence

direct quote[Materials and methods, Immunohistochemistry and immunofluorescence analysis]

“primary antibodies (sc-7961, dilution 1:200, Santa Cruz Biotechnology, Santa Cruz, CA, USA)”

direct quote[Materials and methods, Cell culture]

“The human OSCC cell lines SCC9 and CAL27 were obtained from the Cancer Research Institute of Central South University (Changsha, China).”

direct quote[Materials and methods, ceRNA analysis and target prediction]

“we constructed a has_circRNA_100290-miRNA-target gene network using Cytoscape to visualize their interactions”

WARNReviewer 2· 80% conf

Antibodies and cell lines are identified but lack RRIDs and authentication details; no mycoplasma testing is reported.

Evidence

direct quote[Materials and methods, Immunohistochemistry]

“primary antibodies (sc-7961, dilution 1:200, Santa Cruz Biotechnology)”

paraphrase[Materials and methods, Cell culture]

“Cell lines source is given but no STR or other authentication method is provided.”

absence[Materials and methods]

No mycoplasma testing reported.

WARNReviewer 3· 85% conf

Key reagents including antibodies, siRNAs, commercial kits, and software are identified with sources and catalog numbers, but not all (e.g., cell lines lack authentication method, primer sequences are given but with inconsistent formatting, no RRIDs are used).

Evidence

direct quote[Materials and methods, 'Immunohistochemistry and immunofluorescence analysis']

“primary antibodies (sc-7961, dilution 1:200, Santa Cruz Biotechnology, Santa Cruz, CA, USA)”

direct quote[Materials and methods, 'Cell culture']

“The source of the three cell lines were derived from tongue cancer and have been authenticated in oral cancer research.”

absence[Materials and methods, 'Cell culture']

Mycoplasma testing is not mentioned.

The 'Statistical analysis' section states: 'One-way analysis of variance was applied to compare difference between two groups.' This is methodologically incorrect — one-way ANOVA compares multiple groups, not just two — but likely a writing error; it does not detail post-hoc tests or multiplicity. Exact p-values are given in figures (e.g., **P<0.01). Effect sizes and confidence intervals are not reported. SD is used but the text says 'means±standard deviation' for all quantitative data. The software used (e.g., ABI PRISM, flow cytometry software) is not listed in a dedicated statistics section, though individual instruments are named. Data presentation in figures shows bar graphs with error bars and individual data points are not consistently shown (some bar-only panels). The sample sizes (n) are stated for each group.

Sub-criteria

tests namedINADEQUATE

exact p valuesADEQUATE

effect sizes ciNOT REPORTED

data presentationINADEQUATE

software identifiedINADEQUATE

assumptions verifiedNOT REPORTED

mathematical plausibilityN/A

Per reviewer (3) — the votes behind the verdict

WARNReviewer 1· 80% conf

Statistical tests are named, but assumptions are not verified; exact p-values are not consistently reported; effect sizes and confidence intervals are absent; data presentation shows individual points in some figures but not all; mathematical plausibility cannot be fully assessed due to limited reporting.

Evidence

direct quote[Materials and methods, Statistical analysis]

“One-way analysis of variance was applied to compare difference between two groups.”

direct quote[Figure legends]

“**, P <0.01”

absence[Results]

No effect sizes or confidence intervals reported.

WARNReviewer 2· 75% conf

Statistical tests are named but many p-values are not exact (e.g., P<0.05), effect sizes are absent, and assumptions are not verified.

Evidence

direct quote[Materials and methods, Statistical analysis]

“One-way analysis of variance was applied to compare difference between two groups.”

direct quote[Figure legends (e.g., Figure 3)]

“** P <0.01”

absence[Results and Methods]

No effect sizes or confidence intervals.

WARNReviewer 3· 85% conf

Statistical tests are named (t-test, one-way ANOVA), exact p-values are reported in figures and text, effect sizes are absent, error bars are defined (SD), but assumptions (normality, equal variance) are not verified, and the analysis is minimal ('one-way analysis of variance was applied to compare difference between two groups' is a likely misstatement).

Evidence

direct quote[Materials and methods, 'Statistical analysis']

“One-way analysis of variance was applied to compare difference between two groups.”

absence[Materials and methods, 'Statistical analysis']

No verification of test assumptions is reported.

direct quote[Figure legends and Results text]

“**P<0.01”

The paper does not include a data availability statement. Microarray data (circRNA and mRNA) are not deposited in GEO or any public database. Code used for bioinformatics analysis (ceRNA network, target prediction) is not shared. No mention of data or code availability anywhere in the manuscript.

Sub-criteria

code sharingNOT REPORTED

accession numbersNOT REPORTED

repository depositNOT REPORTED

data availability statementNOT REPORTED

Per reviewer (3) — the votes behind the verdict

FAILReviewer 1· 90% conf

No data availability statement, no repository deposition, no code sharing; microarray data not deposited in a public repository.

Evidence

absence[Entire paper]

No data availability statement.

absence[Results]

Microarray data not deposited in any repository.

FAILReviewer 2· 90% conf

No data or code availability statement is provided; microarray data are not deposited in a public repository.

Evidence

absence[Entire paper]

No data availability statement.

absence[Results, circRNA expression profiles]

No repository deposit for microarray data.

absence[Methods]

No code sharing.

WARNReviewer 3· 90% conf

No data availability statement is present; microarray data are not deposited in a public repository; custom code is not shared; only supplementary files accompany the paper.

Evidence

absence[Paper text (all sections)]

No data availability statement.

absence[Materials and methods]

No repository deposit mentioned.

direct quote[End of paper]

“Supplementary Material Supplementary Data 1 Click here for additional data file.”

Methods sections are detailed (cell culture, transfection, qPCR, luciferase assays, etc.). No reporting guideline (ARRIVE, CONSORT) is mentioned. Limitations are discussed (off-target effects of siRNA, need for more specific methods). Conclusions are generally proportional (circRNA_100290 'may' function as ceRNA). Funding sources (NSFC, High Level Talent Program) and COI (none) are stated.

Sub-criteria

funding coiADEQUATE

trial registrationN/A

reporting guidelineNOT REPORTED

methods completenessADEQUATE

all outcomes reportedINADEQUATE

limitations discussedADEQUATE

conclusions proportionalADEQUATE

Per reviewer (3) — the votes behind the verdict

WARNReviewer 1· 85% conf

Methods are generally detailed enough for replication, but the study is not a clinical trial so registration is not applicable; no reporting checklist referenced; limitations are discussed; conclusions are mostly proportional; funding and COI statements are provided.

Evidence

direct quote[Materials and methods]

“Primers used for quantitative real-time PCR were listed as follows: hsa_circRNA_100290, 5′GTCATTCCCTCTTTAATGGTG3′ (forward) and 5′CAGAACTTCCGCTCTAACATAC3′ (reverse)”

absence[Materials and methods]

No reporting guideline referenced.

direct quote[Acknowledgements]

“This study was supported by National Natural Science Foundation of China (Contract grant number: 81500832)… The authors declare no conflict of interest.”

WARNReviewer 2· 80% conf

Methods are detailed but no reporting checklist is referenced; funding and COI are reported; limitations are discussed.

Evidence

paraphrase[Materials and methods]

“All experimental procedures (cell culture, transfection, microarray, qPCR, western blot) are described.”

direct quote[Discussion]

“due to the difficulty of designing siRNA at the back-splice junction of circRNA, in this study, only one siRNA can specifically target the circular form of SLC30A7 but do not affect its linear form, thus off-target effects have to be considered.”

direct quote[End of manuscript]

“This study was supported by National Natural Science Foundation of China (Contract grant number: 81500832) and High Level Talent Program of Central South University (Contract grant number: 502035026). The authors declare no conflict of interest.”

WARNReviewer 3· 85% conf

Methods are generally detailed enough for replication, funding and COI are reported, but the paper does not reference a reporting guideline, lacks trial registration (not applicable), and does not discuss limitations comprehensively.

Evidence

direct quote[End of paper before references]

direct quote[Discussion, last paragraph]

“However, due to the difficulty of designing siRNA at the back-splice junction of circRNA, in this study, only one siRNA can specifically target the circular form of SLC30A7 but do not affect its linear form, thus off-target effects have to be considered.”

absence[Paper text (all sections)]

No reporting guideline is referenced.

14 copyedit issues flagged (1 major): mostly clarity, typo, consistency.

Checked 61 references: 58 verified — 3 unresolved.

Reproducibility

1 data/code link checked; 1 live.

Αlpha¹ Rigor Action ItemsFinal pass before journal submission

As a post-publication audit, this paper has important reporting gaps that an informed reader should weigh. The missing data availability, the incorrect statistical description (ANOVA for two-group comparison), the contradictory ΔΔCt calculation, and the overstated therapeutic claim are the most serious issues. An erratum to correct the statistical description, the ΔΔCt calculation, and to tone down the therapeutic claim would be warranted. The absence of randomization/blinding and power analysis weakens the reliability of the in vivo experiment.

1.
HIGHdata code
Add a data availability statement to the Methods section, deposit microarray data in a public repository (e.g., GEO), and cite the accession number (e.g., GSE123456).
No data availability statement or repository deposit is present, which is a basic requirement for a data-driven paper and would be flagged by most journals.
2.
HIGHstatistics
Correct the statistical methods description: replace 'One-way analysis of variance was applied to compare difference between two groups' with the correctly named test (e.g., 'Student's t-test for two-group comparisons, one-way ANOVA with post-hoc tests for multiple groups').
The current description is methodologically incorrect and would be a major reviewer objection.
3.
HIGHstatistics
Review the ΔΔCt calculation in the Results (section 'circRNA_100290 serves as a sponge for the miR-29 family'): 2^-0.828 ≈ 0.56, not 1.775; clarify the sign convention or correct the calculation.
A demonstrable arithmetic error in a key quantitative calculation undermines the conclusion about relative expression levels.
4.
HIGHrigor
Describe randomization and blinding methods for the in vivo xenograft experiment (tumour formation) in the 'Tumour formation experiment' subsection.
Animal experiments without blinding and randomization are at high risk of bias, and most journals require this reporting.
5.
HIGHstatistics
Report exact p-values (e.g., p = 0.032) instead of threshold-based asterisks (e.g., P < 0.01) in figures and legends.
Threshold-only p-values are less informative and many journals now require exact values.
6.
HIGHstatistics
Include effect sizes with confidence intervals for key comparisons (e.g., circRNA expression fold-changes, cell proliferation differences).
Effect sizes and CIs provide a more complete picture of the magnitude and precision of effects than p-values alone.
7.
HIGHreporting
Add a statement confirming that written informed consent was obtained from all human tissue donors in the Ethics section.
Informed consent is a standard ethical requirement for human tissue research and is currently not reported.
8.
HIGHreporting
Cite the specific IACUC or animal ethics committee that approved the mouse experiment, with a protocol number.
Currently only the performing centre is named, which is insufficient for demonstrating animal ethics compliance.
9.
HIGHreporting
Tone down or remove the claim that 'circRNAs may be potential targets for OSCC therapy' in the Discussion, as no therapeutic intervention was tested in vivo.
This claim is overstated relative to the evidence (in vitro and xenograft only) and would be flagged by reviewers.
10.
HIGHreporting
Verify the three references that were not found in any registry (listed in the citation check: 'Head and neck tumors', 'A ceRNA hypothesis: the Rosetta Stone of a hidden RNA language' with DOI 10.1016/j.cell.2011.07.014, and 'Expanded identification and characterization of mammalian circular RNAs' with DOI 10.1186/s13059-014-0409-z); correct or replace them if they are incorrect or fabricated.
References that cannot be located in standard registries may be fabricated or contain errors, which is a serious integrity concern.
11.
MEDIUMethics
Report demographics (age, sex, race/ethnicity, comorbidities) of the human tissue donors in the 'Tissue specimens' subsection.
Without demographics, the representativeness of the study sample cannot be assessed and sex as a biological variable cannot be analysed.
12.
MEDIUMrigor
Provide a power analysis or sample-size justification for the microarray (n=5 pairs) and the in vivo experiment (n=3 mice per group).
Sample sizes are small and no justification is provided, which weakens confidence in the findings.
13.
MEDIUMother
Report cell line authentication (STR profiling) and mycoplasma testing results in the 'Cell culture' subsection.
Cell line misidentification and mycoplasma contamination are widespread issues; journals increasingly require this information.
14.
MEDIUMother
Provide RRIDs (Research Resource Identifiers) for antibodies (e.g., CDK6 antibody sc-7961) and cell lines.
RRIDs enable unambiguous identification of key resources and are recommended by many journals.
15.
MEDIUMreporting
Reference a reporting guideline such as ARRIVE for the animal experiment and note which checklist items were followed.
Using reporting guidelines improves completeness and transparency, and many journals require this.
16.
MEDIUMreporting
Describe housing and husbandry conditions for the nude mice (light/dark cycle, temperature, humidity, enrichment) in the 'Tumour formation experiment' section.
Environmental conditions can affect tumour growth and are part of standard ARRIVE reporting.
17.
LOWcopyedit
Fix the stray digit '1' at the beginning of the Abstract and ensure the abstract is a single coherent paragraph.
A formatting error at the start of the paper gives an unprofessional impression.
18.
LOWcopyedit
Standardise the fold-change threshold notation: use '≥2' consistently throughout the Results instead of alternating between 'greater than 2.0' and '⩾2'.
Inconsistent formatting is a minor readability issue.
19.
LOWcopyedit
Remove empty parentheses in the Results (e.g., 'upregulated in OSCC ()') and insert the correct figure reference.
Empty parentheses appear to be incomplete figure callouts from an editing stage.

Full text (52,517 chars)Analyzed: Jul 6, 2026

Αlpha¹ assesses methodological rigor, not the importance of the findings. See how we calibrate →